View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_high_10 (Length: 454)
Name: NF2755_high_10
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 264
Target Start/End: Complemental strand, 35908130 - 35907881
Alignment:
| Q |
20 |
atttgttcttgtacttggtggtggttcttttgatgggttaatgatactgttggctattcgg-----gatgttttgttatgttgttattgatttgtgtttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
35908130 |
atttgttcttgtacttggtggtggttcttttgatgggttaatgatactgttggcaattcggaatgtgttgttttgttatgttgttattgatttgtgtttt |
35908031 |
T |
 |
| Q |
115 |
ttcaggaaatagttacttggataacatggcttgggatctatggagttcaccttttgatcaaggttttgttaatttattgtctttggctattgatttgatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35908030 |
ttcaggaaatagttacttggataacatggcttgggatctatggagttcaccttttgatcaaggttttgttaatttattgtctttggctattgatttgatg |
35907931 |
T |
 |
| Q |
215 |
gatcattatggtgttctatgaagaatggtttattgggttgcttgaaattc |
264 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35907930 |
gatcactatggtgttctatgaagaatggtttattgggttgcctgaaattc |
35907881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 295 - 424
Target Start/End: Complemental strand, 35907850 - 35907721
Alignment:
| Q |
295 |
gcatgtaatttgctgatgttagctttcgatgatgactataactactccgagactcttgactggtttggttgctttggctgtggctatggtaatttttctt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907850 |
gcatgtaatttgctgatgttagctttcgatgatgactataactactccgagactcttgactggtttggttgctttggctgtggctatggtaatttttctt |
35907751 |
T |
 |
| Q |
395 |
gtatttactcaccatgtattttgtttggtc |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35907750 |
gtatttactcaccatgtattttgtttggtc |
35907721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 83 - 180
Target Start/End: Complemental strand, 3362020 - 3361922
Alignment:
| Q |
83 |
tgttttgttatgttgttattgatttgtgttttttcaggaaatagttacttggat----aacatggcttgggatctatggagttcaccttttgatcaaggt |
178 |
Q |
| |
|
|||||||||||||||||| || |||||| |||||||||||||||||||| || ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
3362020 |
tgttttgttatgttgttactgttttgtg---tttcaggaaatagttacttgcatttcatacatggcttttaatctatggagttcatcttttgatcaaggt |
3361924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University