View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_high_24 (Length: 331)
Name: NF2755_high_24
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 38004755 - 38004985
Alignment:
| Q |
19 |
agtgaggaggatccaacgatgctcaaattttcccttggattttagtacggttgattttcagatgattaat---aacttatccaataattagtgtgtgcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38004755 |
agtgaggaggatccaacgatgctcaaattttcgcttggattttagtacggttgattttcagatgattaataataacttatccaataattagtgtgtgcat |
38004854 |
T |
 |
| Q |
116 |
tcaaaagaatggcaaaataaaggaagttctataagataagcatcacatatgaacatttggttattaaaaggagtaagggaatcgatcaccttaatcaagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38004855 |
tcaaaagaatggcaaaataaaggaagttctataagataaccatcacatatgaacatttggttattaaaaggagtaagggaatcgatcaccttaatcaag- |
38004953 |
T |
 |
| Q |
216 |
ggcctggttggaatttcaatattttgagtcttacaa |
251 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| |
|
|
| T |
38004954 |
----tggttggagtttcaatattttgactcttacaa |
38004985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University