View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_high_25 (Length: 324)
Name: NF2755_high_25
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 32432028 - 32431709
Alignment:
| Q |
1 |
gtttgtatcagactttcggtgtttcattgcttttgactgttggttaagtaatagcaagcattgatgaataaatcgtatattatatgattgcattcagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32432028 |
gtttgtatcagactttcggtgtttcattgcttttgactgttgattaagtaatagcaagcattgatgaataaatcgtatattatacgattgcattcagttt |
32431929 |
T |
|
| Q |
101 |
cagttagttgaatctaattgcaattaattagttagttattccaactgttagaagtttgttataccatctgtctggttacttaatcactcttcagttatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32431928 |
cagttagttgaatctaattgcaattaattagttagttattccaactgttagaagtctgttataccatctgtctagttacttaatcactcttcagttatgt |
32431829 |
T |
|
| Q |
201 |
ctctcattttgaggagtgcaggcgagctagaaacactctttccaactttcaccctggcactcactaactcgttaggtggaactcctacgagtaagagtgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32431828 |
ctctcattttgaggagtgcaggcgagctagaaacactctttccaactttcaccctggcactcactaactcgttaggtggaactcctacgagtaagagtgg |
32431729 |
T |
|
| Q |
301 |
gacctacattcatctcactc |
320 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
32431728 |
gacctacattcatttcactc |
32431709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University