View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_low_18 (Length: 390)
Name: NF2755_low_18
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 384
Target Start/End: Complemental strand, 42664159 - 42663777
Alignment:
| Q |
1 |
tttatatgataaaattaatttcaatatctttttaattatggtattaattttgctattcttttaagggaagagcaatgctatttcgtacggggaattgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664159 |
tttatatgataaaattaatttcaatatctttttaattatggtattaattttgctattcttttaagggaagagcaatgctatttcgtacggggaattgaac |
42664060 |
T |
 |
| Q |
101 |
acacgaaacacatgatagagagaaattggctattacaattattttttatataac-nnnnnnnntataatttcagtctttcacggaaaacacgaagctgct |
199 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42664059 |
acacgaaacacatgatagatagaaattgactattacaattattttttatataacaaaaaaaaatataatttcagtctttcacggaaaacacggagctgct |
42663960 |
T |
 |
| Q |
200 |
agttagtttcttgcatttagtattagtaagaaatagtattatctattgtaccnnnnnnnnnngaaatagtattatccattaagggaaagatagacaaaat |
299 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42663959 |
agttagtttcttgcatttagtattcgtaagaaatagtattatccattgtacc--aaaaaaaagaaatagtattatccattaagggaaagatagacaaaat |
42663862 |
T |
 |
| Q |
300 |
agatnnnnnnnntagcgaatagttcttgactattcttgctgtgagatcaactgagctccaccgccaacacccctatctctgctgc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
42663861 |
agataaaaaaaatagcgaatagttcttgactattcttgctgttagatcaaccgagctccaccgccaacacccctatctctactgc |
42663777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University