View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_low_34 (Length: 306)
Name: NF2755_low_34
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 31 - 139
Target Start/End: Original strand, 13049252 - 13049370
Alignment:
| Q |
31 |
atgtgatggaaattaattgctacagtacttggtaaattttactaccttaggtaccctcttatatatatg----------tactgtcatgtattgtggcta |
120 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
13049252 |
atgtgatggaaattaattgctgaagcacttggaaaattttactaccttaggtaccctcttatatttatgtactgaaagttactgtcatgtattgtggcta |
13049351 |
T |
|
| Q |
121 |
acatttttacaattattac |
139 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
13049352 |
acatttttacgattattac |
13049370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 33469363 - 33469435
Alignment:
| Q |
152 |
tacagtatttgtcttatttaagtgatgtgacattttttctacaccat----cccaagttaggaagaataagga |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| || || |||||||||||||||||||||| |
|
|
| T |
33469363 |
tacagtatttgttttatttaagtgatgtgacattttttctatactatcccacccaagttaggaagaataagga |
33469435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University