View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2755_low_45 (Length: 205)
Name: NF2755_low_45
Description: NF2755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2755_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 183
Target Start/End: Original strand, 18606094 - 18606257
Alignment:
| Q |
16 |
atactaaattgatctatcctttaacccctnnnnnnnnntgaacatcctttaaaataatatttcaataataaaacatttaatccaaaataagaaccaatga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18606094 |
atactaaattgatctatcctttaacccctaaaaaaaa-tgaacatcctttaaaata---tttcaataataaaacatttaatccaaaataagaaccaatga |
18606189 |
T |
|
| Q |
116 |
aagtcaaccacataactaacaacaaaattttggacaaacacattataatatatagattaatggtaatc |
183 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18606190 |
aagtcaaccacataactaacagcaaaattttggacaaacacattataatatatagattaatggtaatc |
18606257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University