View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2756_high_4 (Length: 222)

Name: NF2756_high_4
Description: NF2756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2756_high_4
NF2756_high_4
[»] chr5 (1 HSPs)
chr5 (59-204)||(39336412-39336557)
[»] chr3 (1 HSPs)
chr3 (147-197)||(7295060-7295110)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 59 - 204
Target Start/End: Original strand, 39336412 - 39336557
Alignment:
59 tccattcaagatggaagaagcagggttggctgctatcattaagaagcagacctcaacggagaaaactagtggcaccatcaagacatgtcattttgaggta 158  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39336412 tccattcaagatggaagaagcagggttggctgctatcattgagaagcagacctcaacggagaaaactagtggcaccatcaagacatgttattttgaggta 39336511  T
159 gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
39336512 gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct 39336557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 197
Target Start/End: Complemental strand, 7295110 - 7295060
Alignment:
147 cattttgaggtagcattgagtaaagtctctccgtctgtgtcgaaaatggta 197  Q
    ||||||||||||||| ||| |||||||||||||||||||||  ||||||||    
7295110 cattttgaggtagcactgactaaagtctctccgtctgtgtcagaaatggta 7295060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University