View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2756_high_4 (Length: 222)
Name: NF2756_high_4
Description: NF2756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2756_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 59 - 204
Target Start/End: Original strand, 39336412 - 39336557
Alignment:
| Q |
59 |
tccattcaagatggaagaagcagggttggctgctatcattaagaagcagacctcaacggagaaaactagtggcaccatcaagacatgtcattttgaggta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39336412 |
tccattcaagatggaagaagcagggttggctgctatcattgagaagcagacctcaacggagaaaactagtggcaccatcaagacatgttattttgaggta |
39336511 |
T |
 |
| Q |
159 |
gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336512 |
gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct |
39336557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 197
Target Start/End: Complemental strand, 7295110 - 7295060
Alignment:
| Q |
147 |
cattttgaggtagcattgagtaaagtctctccgtctgtgtcgaaaatggta |
197 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
7295110 |
cattttgaggtagcactgactaaagtctctccgtctgtgtcagaaatggta |
7295060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University