View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2756_low_3 (Length: 235)
Name: NF2756_low_3
Description: NF2756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2756_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 184
Target Start/End: Complemental strand, 27873820 - 27873656
Alignment:
| Q |
20 |
ggaacgaaaactcgagtaactgcagacctgctgttacattaaaatgcaaaagtttaacacacataaccatacaaattgaattctaactttgttctataaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873820 |
ggaacgaaaactcgagtaactgcagacctgctgttacattaaaatgcaaaagtttaacacacataaccatacaaattgaattctaactttgttctataaa |
27873721 |
T |
 |
| Q |
120 |
tttgataaagaataacagattaaaaaattcctaaacaaattgaattttaaatttgttttatttgc |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873720 |
tttgataaagaataagagattaaaaaattcctaaacaaattgaattttaaatttgttttatttgc |
27873656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 27873639 - 27873607
Alignment:
| Q |
203 |
tccttcaattaccatgtttctcttcaaccaatc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27873639 |
tccttcaattaccatgtttctcttcaaccaatc |
27873607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University