View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2759_high_11 (Length: 237)
Name: NF2759_high_11
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2759_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 29998986 - 29999138
Alignment:
| Q |
1 |
gcttctctgtccacagaaaaacgtgtacaccaacttggagttcttgatatcttcaacctcgttacttcagccaaaccaaaccatccattgtggtcatgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29998986 |
gcttctctgtccacagaaaaacgtgtacaccaacttggagttcttgatatcttcaacctcgttacttcagccaaaccaaatcattcattgtggtcatgtc |
29999085 |
T |
|
| Q |
101 |
ttttgcagcaacaactatgctctatttccttctcttcactttcatataccttt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999086 |
ttttgcagcaacaactatgctctatttccttctcttcactttcatataccttt |
29999138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 29999422 - 29999484
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcgcagtatgaggaaattttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999422 |
tggttctaaagggttgcctttttctgagtatggtccttattggcgcagtatgaggaaattttg |
29999484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 30005860 - 30005922
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcgcagtatgaggaaattttg |
221 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30005860 |
tggttccaaagggatggctttttctgagtatggtccttattggcgtagtgtgaggaaattttg |
30005922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 29952008 - 29952070
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcgcagtatgaggaaattttg |
221 |
Q |
| |
|
|||||| ||||||||| |||||||| ||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
29952008 |
tggttccaaagggttggctttttctaagtatggtccttattggcgtagtgtgaggaaactttg |
29952070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 221
Target Start/End: Complemental strand, 30045294 - 30045232
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcgcagtatgaggaaattttg |
221 |
Q |
| |
|
|||||| |||||| || |||||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30045294 |
tggttccaaagggatggctttttgtgagtatggtccttattggcgtagtgtgaggaaattttg |
30045232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 29963113 - 29963157
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcg |
203 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29963113 |
tggttccaaagggttggctttttctgagtatggtccttattggcg |
29963157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 30011685 - 30011641
Alignment:
| Q |
159 |
tggttctaaagggttgcctttttctgagtatggtccttattggcg |
203 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30011685 |
tggttccaaagggttggctttttctgagtatggtccttattggcg |
30011641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 30071106 - 30071062
Alignment:
| Q |
177 |
tttttctgagtatggtccttattggcgcagtatgaggaaattttg |
221 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30071106 |
tttttctgactatggtccttattggcgtagtgtgaggaaattttg |
30071062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 107
Target Start/End: Complemental strand, 30071501 - 30071457
Alignment:
| Q |
63 |
tacttcagccaaaccaaaccatccattgtggtcatgtcttttgca |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
30071501 |
tacttcagccaaaccaaaccattcattgtagacatgtcttttgca |
30071457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 107
Target Start/End: Original strand, 30005483 - 30005527
Alignment:
| Q |
63 |
tacttcagccaaaccaaaccatccattgtggtcatgtcttttgca |
107 |
Q |
| |
|
|||||||||||||||||| ||| |||||| | ||||||||||||| |
|
|
| T |
30005483 |
tacttcagccaaaccaaagcattcattgtagacatgtcttttgca |
30005527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University