View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2759_high_6 (Length: 299)
Name: NF2759_high_6
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2759_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 94 - 285
Target Start/End: Original strand, 40623005 - 40623196
Alignment:
| Q |
94 |
taacatgtagttacttcattagaatgtctgtaacccttttaatttgtaactttcagtttccttggaactctctcaacttggctgctatgatagttatcat |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40623005 |
taacatgtagttacttcattagaatgtttgtaacccttttaatttgtaactttcagtttccttggaactctctcaacttggctgctatgatagttatcat |
40623104 |
T |
 |
| Q |
194 |
taattatgtttcatgnnnnnnnnagcactctttggtgcaggtttcttctactcactctcactctctcttttccttaataaggacaaaccaat |
285 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40623105 |
taattatgtttcatgttttttttagcactctttggtgcaggtttcttctactcactctcactctctcttttccttaataaggacaaaccaat |
40623196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University