View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2759_low_13 (Length: 232)

Name: NF2759_low_13
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2759_low_13
NF2759_low_13
[»] chr1 (1 HSPs)
chr1 (43-223)||(19887878-19888058)
[»] chr7 (1 HSPs)
chr7 (43-222)||(35319077-35319256)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 19887878 - 19888058
Alignment:
43 cattaaggagcggcgtgctaaggaggattttagacgaagttcttcgattttggcgactacgtcaatggagagatgcttggctaggatttcaggtgggaga 142  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19887878 cattaaggagcgccgtgctaaggaggattttagacgaagttcttcgattttggcgactacgtcaatggagagatgcttggctaggatttcaggtgggaga 19887977  T
143 ccagacttggcaacaaggtgggaacatgttgtccaaagttgtggcatttcttgctttcttgaagctattagtactttcatc 223  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
19887978 ccagacttggcaacaaggtgggaacatgttgtccaaagttggggcatttcttgctttcttgaagctattagtactttcatc 19888058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 222
Target Start/End: Complemental strand, 35319256 - 35319077
Alignment:
43 cattaaggagcggcgtgctaaggaggattttagacgaagttcttcgattttggcgactacgtcaatggagagatgcttggctaggatttcaggtgggaga 142  Q
    ||||||||||||||||| |||||||| ||| |  ||||| |||||||||||||| |  |  ||||| | |||||| || || || | ||| || || |||    
35319256 cattaaggagcggcgtgataaggaggttttgatgcgaagctcttcgattttggctatgatatcaatagggagatgttttgcaagtacttctggaggaaga 35319157  T
143 ccagacttggcaacaaggtgggaacatgttgtccaaagttgtggcatttcttgctttcttgaagctattagtactttcat 222  Q
    || || || || ||||||||||||||||| ||||| || ||  |||| ||||| |||||||| ||||  || ||||||||    
35319156 cctgattttgctacaaggtgggaacatgtggtccatagctggtgcatgtcttgttttcttgatgctaggagcactttcat 35319077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University