View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2759_low_4 (Length: 306)
Name: NF2759_low_4
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2759_low_4 |
 | |
|
| [»] scaffold0023 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0023 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 284
Target Start/End: Original strand, 112147 - 112413
Alignment:
| Q |
19 |
gaatcgtgatccctagatatcccagttattgattagaaaacctactaatcctatcgtaacctttctcacgaccatcttcccaaccattcactgtgtttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112147 |
gaatcgtgatccctagatatcccagttattgattagaaaacctactaatcctatcgtaacctttctcacgaccatcttcccaaccattcactgtgtttgt |
112246 |
T |
|
| Q |
119 |
tgctcttcggttgtctatattgtccctgcaccaccgg-tccatcgctttctgacgtctgtttcttacctcagtctgtttgtgcctcgccaacaattggcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112247 |
tgctcttcggttgtctatattgtccctgcaccaccggttccatcgctttctgacgtctgtttcttacctcagtctgtttgtgcctcgccaacaattggcc |
112346 |
T |
|
| Q |
218 |
caccccatctgacaaacttcacttctagagaatgatgtcgccggtacggtggaacgaggccattgca |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
112347 |
caccccatctgacaaacttcacttctagagaatgatgtcgccggtagggtggaacgaggctattgca |
112413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University