View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2759_low_8 (Length: 284)
Name: NF2759_low_8
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2759_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 54 - 262
Target Start/End: Complemental strand, 1155501 - 1155291
Alignment:
| Q |
54 |
ttattaaatatgttttttccttt--acaacatccctaccacaccaccatcatcccataaatcactacaacaccacatgattaaatgtagaagtnnnnnnn |
151 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1155501 |
ttattaaatatgttttttccttctcacaacatccctaccacaccaccatcatcccataaatcactacaacaccacatgattaaatgcagaagtaataaaa |
1155402 |
T |
|
| Q |
152 |
nnnnnnnnnngaaattcaatctgtaacttgataacaaaattgaatcgcaaaatatgtctctctcacttcaccaactctctcgcttctctattttcggtcg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1155401 |
acctaaaaaagaaattcaatctgtaacttgataacaaaattgaatcgcaaaatatgtctctctcacttcaccaactctctcgcttctatattttccgtcg |
1155302 |
T |
|
| Q |
252 |
ctaaaatatat |
262 |
Q |
| |
|
||||||||||| |
|
|
| T |
1155301 |
ctaaaatatat |
1155291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University