View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2759_low_9 (Length: 272)
Name: NF2759_low_9
Description: NF2759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2759_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 38294564 - 38294824
Alignment:
| Q |
1 |
acttagccctcctgcattcttagagcagcaagaagttttgtcatgataatgtcttcttggagattggttaaattaattaaaaagtgattttttcttcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38294564 |
acttagccctcctgcattcttagagcagcaagaagttttgtcatgataatgtcttcttggagattggttaaattaattaaaaagtgattttttcttcttg |
38294663 |
T |
|
| Q |
101 |
aggtatatttgtatgggatctgatccacatactatttactccataatctaagctaattgcattagcaccaaaaagataaaagtggggacaaagtgaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38294664 |
aggtatatttgtatgggatctgatccatatactatttactccataatctaagctaattgcattagcaccaaagagataaaagtggggacaaagtgaatct |
38294763 |
T |
|
| Q |
201 |
ttatttcatcctgatggattttaaaggttgtccttgatcttttccacgtcataattgatga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38294764 |
ttatttcatcctgatggattttaaaggttgtccttgatcttttccacgtcataattaatga |
38294824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University