View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2760_low_5 (Length: 231)
Name: NF2760_low_5
Description: NF2760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2760_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 11314087 - 11314302
Alignment:
| Q |
5 |
cattttttaattatgtaaaaagactaaagttttgattaaattttcttgtagggttgagcttttgattcttgggttgtgtgacaacattaaactgcacgtc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11314087 |
cattttttaattatgtaaaaagactaaagttttgattaaattttcttgtagggttgagcttttgattcttgggttgtgtgacaacattaaactgcacatc |
11314186 |
T |
 |
| Q |
105 |
aaagttaacaagtttaagactgtttggttggtgtgttcaaaaaatggaaacttgtacggctctattacttttaacggccataacagcttacttgctttgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11314187 |
aaagttaacaagtttaagactgtttggttggtgtgttcaaaaaatggaaacttgtacggctctattacttttaacggccataacagcttacttgctttgg |
11314286 |
T |
 |
| Q |
205 |
ttcaccttcatctcac |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11314287 |
ttcaccttcatctcac |
11314302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University