View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2760_low_6 (Length: 217)
Name: NF2760_low_6
Description: NF2760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2760_low_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 40395446 - 40395229
Alignment:
| Q |
1 |
atatagatcctttagacagtgaatatgagatnnnnnnncactgacagattgaaatgattcaaatgtcactacaccaaacaaatttccttaaggctataag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40395446 |
atatagatcctttagacagtgaatatgagataaaaaaacactgacagattgaaatgattcaaatgtcactacaccaaacaaatttccttaaggctataag |
40395347 |
T |
 |
| Q |
101 |
acacacctcatattgacatttgacaggtatctgttatggcttattataatagtaaaggaacctactttctgtttcattttgaa-nnnnnnnatggtttaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40395346 |
acacacctcatattgacatttgacaggtatctgttatggcttattataatagtaaaggaacctactttctgtttcattttgaattttttttatggtttaa |
40395247 |
T |
 |
| Q |
200 |
tcaggtttatttctttat |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40395246 |
tcaggtttatttctttat |
40395229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University