View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2761_high_13 (Length: 436)
Name: NF2761_high_13
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2761_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 35 - 419
Target Start/End: Complemental strand, 40965666 - 40965282
Alignment:
| Q |
35 |
gatatttcttgagtaatggtaggttctagaaagggttcaaaatcagaatttttgttcttgacatgaagaataacaaggggctttattggagtatgtggaa |
134 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40965666 |
gatatttcttgagcaatggtaggttctagaaagggttcaaaatcagaatttttgttcttgacatgaagaataacaaggggctttattggagtatgtggaa |
40965567 |
T |
|
| Q |
135 |
gagtacaaaactgagaagagaatttggttgtagagcgagaagtagaaggagcatagaagcaattcatagacctagtaatggtgggaagtggcgatgatgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40965566 |
gagtacaaaactgagaagagaatttggttgtagagcgagaagtagaaggaacatagaagcaattcatagacctagtaatggtgggaagtggcgatgatgg |
40965467 |
T |
|
| Q |
235 |
atgaattcgccacggttgaacggttgaagatttaatcaaatccattcggtttttctcagaaaggacaaagtgtgatgtgatatgaaaatattactgattt |
334 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40965466 |
aggaattcgccgcggttgaacggttgaagatttaatcaaatccattcggtttttctcagaaaggacaaagagtgatgtgatatgaaaatattactgattt |
40965367 |
T |
|
| Q |
335 |
atatttggagggaatacatatgggccaagctcgtcccatacatctaaagcaatgctatcatgaaagatggtttcttttttcacct |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40965366 |
atatttggagggaatacatatgggccaagctcgtcccatacatctaaagcaatgctatcatgaaagataatttcttttttcacct |
40965282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University