View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2761_high_43 (Length: 225)
Name: NF2761_high_43
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2761_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 4043187 - 4042998
Alignment:
| Q |
17 |
aatatctcgtattgtcagcaaacggaaaccgccaccaacgatcggttcagcttgaatttctaagttgggcattttggagaactgataagtgagaacggca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4043187 |
aatatctcgtattgtcagcaaacggaaaccgccaccaacgatcggttcagcttgaatttctaagttgggcattttggagaactgataagtgagaacggca |
4043088 |
T |
 |
| Q |
117 |
cataaaggtttgggagtgagagagaaaggtttgggagcgataagtgagaacgagagagaaaggttaaatcttaaataagaatgttggact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4043087 |
cataaaggtttgggagtgagagagaaaggtttgggagcgataagtgagaacgagagagaaaggttaaatcttaaataagaatgttggact |
4042998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University