View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2761_low_34 (Length: 250)
Name: NF2761_low_34
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2761_low_34 |
 | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 12789861 - 12789622
Alignment:
| Q |
1 |
taaaattgtatataactgctacaggtgcattggctcactacaattcaaatgtcattatttaaaggttatagaggacaaaccattattttgggtgtttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12789861 |
taaaattgtatataactgctacaggtacattggctcactacaattcaaatgtcattatttaaaggttatagaggacaaaccattattttgggtgtttaaa |
12789762 |
T |
|
| Q |
101 |
ttgtaagtgtcggacacccgtttactgtacatgtcttagggatttgtagtctagattctggcgtgtcgatcgtttttgctttgagttcggaagtcagggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||| |
|
|
| T |
12789761 |
ttgtaagtgtcggacacccgtttactgtacatgtcttagggatttgtagtctagattctggtggacagatcgtttttgctttgagtttggaagtcagggt |
12789662 |
T |
|
| Q |
201 |
ctagtttcatgtttttgagatggttacggtgttctctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12789661 |
ctagtttcatgtttttgagatggttacagtgttctctctg |
12789622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 238
Target Start/End: Complemental strand, 15841092 - 15841027
Alignment:
| Q |
173 |
tttttgctttgagttcggaagtcagggtctagtttcatgtttttgagatggttacggtgttctctc |
238 |
Q |
| |
|
||||||||| ||| |||||||| || ||||||||||| ||||||| |||||||| |||||| |||| |
|
|
| T |
15841092 |
tttttgcttcgagatcggaagttagcgtctagtttcaagtttttgtgatggttaaggtgttttctc |
15841027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 232
Target Start/End: Complemental strand, 64480 - 64413
Alignment:
| Q |
165 |
gtcgatcgtttttgctttgagttcggaagtcagggtctagtttcatgtttttgagatggttacggtgt |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
64480 |
gtcgatcgcttttgctttgagatcggaagttgacgtctagtttcatgttttttggatggttaaggtgt |
64413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 232
Target Start/End: Complemental strand, 69621 - 69554
Alignment:
| Q |
165 |
gtcgatcgtttttgctttgagttcggaagtcagggtctagtttcatgtttttgagatggttacggtgt |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
69621 |
gtcgatcgcttttgctttgagatcggaagttgacgtctagtttcatgttttttggatggttaaggtgt |
69554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University