View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2761_low_36 (Length: 250)
Name: NF2761_low_36
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2761_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 236
Target Start/End: Original strand, 21486214 - 21486437
Alignment:
| Q |
13 |
ggatgttggcagagaattaactgcatacagtattaattatcatttcatttctctgtgaacaaaccttcataaatagatgtgactgtttatttcctatttt |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21486214 |
ggatgttggcagagaattaattgcatacagtattaattatcatttcatttatctgtgaacaaaccttcataaatagatgtgactttttatttcctatttt |
21486313 |
T |
 |
| Q |
113 |
cctttctggccttgtggatctgactagagttaagtgcttattgtaatgattattttctttcttagtgaaaatatctgacgctcagggcccttgaatctga |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21486314 |
cctttctggccttgtggatgtgactagagttaagtgcttattgtaatgattattttctttcttagtgaaaatatctgacgctcagggcccttgaatctga |
21486413 |
T |
 |
| Q |
213 |
tatcaaacaaaaatagttgttggt |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
21486414 |
tatcaaacaaaaatagttgttggt |
21486437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University