View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2761_low_43 (Length: 231)
Name: NF2761_low_43
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2761_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 42 - 172
Target Start/End: Complemental strand, 4238872 - 4238742
Alignment:
| Q |
42 |
tttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattgata |
141 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4238872 |
ttttttttattatatcacggttttaattagttgaatattcaatagatcatactagagtcatgcaagtattattccgtacttaaacttaatttgattgata |
4238773 |
T |
 |
| Q |
142 |
tttgaattatatctggttacatatatagtta |
172 |
Q |
| |
|
||| |||||| |||||||||||||||||||| |
|
|
| T |
4238772 |
tttcaattatgtctggttacatatatagtta |
4238742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 39 - 160
Target Start/End: Complemental strand, 19921039 - 19920922
Alignment:
| Q |
39 |
taatttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattg |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19921039 |
taatttttaatattatatcacggttttaattagttgaatattcaatagatcacactagagtcatgcaagtattattccat-cttaaacttaatttgat-- |
19920943 |
T |
 |
| Q |
139 |
atatttgaattatatctggtta |
160 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
19920942 |
-tatttgaattatatctagtta |
19920922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University