View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2761_low_43 (Length: 231)

Name: NF2761_low_43
Description: NF2761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2761_low_43
NF2761_low_43
[»] chr1 (1 HSPs)
chr1 (42-172)||(4238742-4238872)
[»] chr3 (1 HSPs)
chr3 (39-160)||(19920922-19921039)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 42 - 172
Target Start/End: Complemental strand, 4238872 - 4238742
Alignment:
42 tttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattgata 141  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||    
4238872 ttttttttattatatcacggttttaattagttgaatattcaatagatcatactagagtcatgcaagtattattccgtacttaaacttaatttgattgata 4238773  T
142 tttgaattatatctggttacatatatagtta 172  Q
    ||| |||||| ||||||||||||||||||||    
4238772 tttcaattatgtctggttacatatatagtta 4238742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 39 - 160
Target Start/End: Complemental strand, 19921039 - 19920922
Alignment:
39 taatttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattg 138  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||  ||||||||||||||||||  | |||||||||||||||||      
19921039 taatttttaatattatatcacggttttaattagttgaatattcaatagatcacactagagtcatgcaagtattattccat-cttaaacttaatttgat-- 19920943  T
139 atatttgaattatatctggtta 160  Q
     |||||||||||||||| ||||    
19920942 -tatttgaattatatctagtta 19920922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University