View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2762_low_16 (Length: 286)
Name: NF2762_low_16
Description: NF2762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2762_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 8 - 274
Target Start/End: Original strand, 18010866 - 18011132
Alignment:
| Q |
8 |
tgagatgaatctgatgaaatgttgttatgatctcttccaaccgatttttgatctgaatcgagtagttgatgatcaactttatttgaagaagaagttgatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18010866 |
tgagatgaatctgatgaaatgttgttctgatctcttccaaccgatttttgatctgaatcgagtagttgatgatcaactttatttgaagaagaagttgatg |
18010965 |
T |
|
| Q |
108 |
gtttgtgaaaatctccaaagttttgaatttttgattctatcacactttttatatcgaaccaatcatctaccatttgctcggaatctttgcttcttgagga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18010966 |
gtttgtgaaaatctccaaagttttgaatttttgattctatcacactttttatatcgaaccaatcatctaccatttgctcggaatctttgcttcttgagga |
18011065 |
T |
|
| Q |
208 |
tgatccgcaaataggtaacgagatcgatttggctcgtctcgatttacgattaggttgttgattatga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18011066 |
tgatccgcaaataggtaacgagatcgatttggctcgtctcgatttacgattaggttgttgattatga |
18011132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University