View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2762_low_17 (Length: 273)
Name: NF2762_low_17
Description: NF2762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2762_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 1033300 - 1033582
Alignment:
| Q |
1 |
cattttacactgatggtgtatcaaaattttattgtactcttttttgttttgctatggtaaatggtgttacagtagtgactgttgtcttcagttgcaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1033300 |
cattttacactgatggtgtatcaaaattttattgtactcttttttgttttgctatggtaaatggtgttgtagtagtgactgttgtcttcagttgcaggaa |
1033399 |
T |
|
| Q |
101 |
cctagtaaagaattgccaaagctactggataatgcttcatatttgattcatttggctgtttttggtattctcggggtaatattctatcctccgaacctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1033400 |
cctagtaaagaattgccaaagctactggataatgcttcatatttgattcatttggctgtttttggtattctcggggtaatattctatcctccgaacttca |
1033499 |
T |
|
| Q |
201 |
----------atgcgagtagttaatagcttttggtttagtattatttccgtataaccattacttgagttacgatatttgagta |
273 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1033500 |
atgataaaatatgcgagtagttaatcacttttggtttagtattatttccatataaccattacttgagttacgatatttgagta |
1033582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University