View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2762_low_18 (Length: 271)
Name: NF2762_low_18
Description: NF2762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2762_low_18 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 118 - 255
Target Start/End: Complemental strand, 149871 - 149734
Alignment:
| Q |
118 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
 |
| Q |
218 |
tgaaacatataatggagttgaaataaaagggtttgttc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttc |
149734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University