View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2762_low_7 (Length: 427)
Name: NF2762_low_7
Description: NF2762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2762_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 268
Target Start/End: Complemental strand, 32235751 - 32235492
Alignment:
| Q |
9 |
gagatgaaaccggtgaaatttctgagtcatggttcaattggtctaactaaccaattgtggttcaacctagtttgatctggctctaccgaactatggttga |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32235751 |
gagatgaaaccggtgaaacttctgagtcatggttcaattggtctaactaaccaattgtggttcaacctagtttgatctggctctaccaaactatggttga |
32235652 |
T |
|
| Q |
109 |
accaaccaaaagactagctgattctcaattcaaccagttgaaccggccggtttggtccagttttgacaacattgcttaaacatttactatgtgataagat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32235651 |
accaaccaaaagactagctgattctctaatcaaccagttgaaccggccggtttggtccagttttgacaacattgcttaaacatttactatgtgataagat |
32235552 |
T |
|
| Q |
209 |
agtaaaatatgattggaagtctcttgtaaacttgttaacatagtgtagagttcttaaacc |
268 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
32235551 |
agtaaaatatgattggaagtctcttttaaacttgttaacatagtgtagatttcttaaacc |
32235492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 337 - 411
Target Start/End: Complemental strand, 32235426 - 32235352
Alignment:
| Q |
337 |
ctaaaacacatgatctaacattagtgtcttgaaatgttggctgacatgtgacaataactgttggcagagttttgt |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32235426 |
ctaaaacacatgatctaacattagtgtcttgaaatgttggctgacatgtgacaataactgttggcagagctttgt |
32235352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University