View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2763_high_11 (Length: 276)
Name: NF2763_high_11
Description: NF2763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2763_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 268
Target Start/End: Original strand, 8796466 - 8796720
Alignment:
| Q |
17 |
attaatagcctcgtatttgaccccctcaatcttaaaaagacctcaccttgacctcaatgttacttnnnnnnngaaaa---tgctaattcctttagatgca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8796466 |
attaatagcctcgtatttgaccccctcaatcttaaaaagacctcaccttgacctcaatgttacttaaaaaaaaaaaaaaatgctaattcctttagatgca |
8796565 |
T |
 |
| Q |
114 |
caactttattcctcattattttttccctaaaatattccctttatgtatactcgtagccgtccnnnnnnncttaagtctaattcaagcttccttctataaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8796566 |
caactttattcctcattattttttccctaaaatattccctttatgtatactcgtagccgtcctttttttcttaagtctaattcaagcttccttctataaa |
8796665 |
T |
 |
| Q |
214 |
ccccaggtcttatcagcactatagttgattcctcccaaaaatacttcattcatct |
268 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796666 |
ccccaggtcttgtcagcactatagttgattcctcccaaaaatacttcattcatct |
8796720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University