View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2763_high_13 (Length: 260)
Name: NF2763_high_13
Description: NF2763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2763_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 43818504 - 43818252
Alignment:
| Q |
1 |
cttccctccatgagtatccctatgtaatttctggatgtaaatgaaattccaccaaggacagtactagagaaaaatgcagatcattttcctttatccnnnn |
100 |
Q |
| |
|
||||||||||||||||||| |||| || ||||| | |||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43818504 |
cttccctccatgagtatcctcatgtcatgtctggtggcgaatgaaattccaccaaggggagtaacagagaaaaatgcagatcattttcctttatcctttt |
43818405 |
T |
 |
| Q |
101 |
nnnc-cttagttgttttcccctttcagatggagattatattagtaacaactctccctagtcattaagtgaataattagacctttatctctgtaatgtttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43818404 |
tttttcttagttgttttcccctttcagatggagattatattagtaacaactctccctagtcattaagtgaataattagacctttacctttgtaatgtttt |
43818305 |
T |
 |
| Q |
200 |
gaagggtgttttgcatttttagtgttcattttgattttgtatatatgatgatg |
252 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43818304 |
gaagggtgttttgcattttcagtgttcattttgattttgtatatatgatgatg |
43818252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University