View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2763_high_8 (Length: 321)
Name: NF2763_high_8
Description: NF2763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2763_high_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 5 - 321
Target Start/End: Complemental strand, 2557272 - 2556956
Alignment:
| Q |
5 |
tatgtgtgggacactggatactccttcattatgaaacagaggtggaccctcgtagagctgagtatgtacccctgcactgtacaccctgagattttaaaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2557272 |
tatgtgtgggacactggatactccttcattatgaaacagaggtggaccctcgtagagctgagtatgtacccctgcactgtacaccctgagattttaaaac |
2557173 |
T |
|
| Q |
105 |
taaagaatagttttctgaaccccctgacctaaaacttttgtagcaaatgcccaaaataaacattctcatttatcactgttcccatgtgacagcaacagcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2557172 |
taaagaatagttttctgaaccccctgacctaaaaattttgtagcaaatgcccaaaataaacattctcatttatcactgttcccatgtgacagcaacagcc |
2557073 |
T |
|
| Q |
205 |
aaaatgagtgacttcacatcttctctcctgggatttgtgaaaccaaaaataaccctgcactgccacagttcccttcttggaccctagctgcaccagtaca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2557072 |
aaaatgagtgacttcacatcttctctcctgggatttgtgaaaccaaaaataaccctgcactgccacagttcccttcttggaccctagctgcaccagtaca |
2556973 |
T |
|
| Q |
305 |
ctcaattgcggttccct |
321 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
2556972 |
ctaaattgcggttccct |
2556956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University