View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2763_low_10 (Length: 290)
Name: NF2763_low_10
Description: NF2763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2763_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 27 - 275
Target Start/End: Complemental strand, 43818756 - 43818507
Alignment:
| Q |
27 |
tatcattaagttgttcatagatagatagaagttgttcattaaaaagataaattgatatacaaatattattt-atttttctttgaatgtcatgtcaggagt |
125 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43818756 |
tatcatcaagttgttcatagatagatagaagttgttcattaaaaagataaattgatatacaaatattattttatttttctttgaatgtcatgtcaggagt |
43818657 |
T |
 |
| Q |
126 |
ttgatgcaagatatggtggtggatggcaatgtgtggtaggttcaagttttgggtgttttttcactcattctaagggaacattcatatacttcactcttga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43818656 |
ttgatgcaagatatggtggtggatggcaatgtgtggtaggttcaagttttggctgttttttcactcattctaagggaacattcatatacttcactcttga |
43818557 |
T |
 |
| Q |
226 |
gactctcaatttccttatcttcaaaggagtttgagctaacttttcttcat |
275 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43818556 |
gactctcaatttccttattttcaaaggagtttgagctactttttcttcat |
43818507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University