View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_high_34 (Length: 330)
Name: NF2766_high_34
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 9 - 322
Target Start/End: Complemental strand, 1055367 - 1055047
Alignment:
| Q |
9 |
gagaagagtgaggttaacgtcgttagtggaacggaaacggaaagtgtgacggtaacggtgagcttgagagggtgagatgaagaaggaagagatggatgga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1055367 |
gagaagagtgaggttaacgtcgttagtggaacggaaacggaaagtgtgacggtaacggtgagcttgagagggtgagatgaagaaggaggagatggatgga |
1055268 |
T |
 |
| Q |
109 |
gttggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttttgtgattggtttcttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1055267 |
gttggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttttgtgattggtttcttta |
1055168 |
T |
 |
| Q |
209 |
t-------tattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctatttgaacccnnnnnnnaggt |
301 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1055167 |
ttatttattattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctatttgaaccctttttttaggt |
1055068 |
T |
 |
| Q |
302 |
aatacacccacatttcttttc |
322 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1055067 |
aatacacccacatttcttttc |
1055047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University