View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2766_high_39 (Length: 288)

Name: NF2766_high_39
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2766_high_39
NF2766_high_39
[»] chr8 (1 HSPs)
chr8 (16-153)||(10520506-10520643)
[»] chr3 (1 HSPs)
chr3 (34-153)||(241601-241720)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 16 - 153
Target Start/End: Complemental strand, 10520643 - 10520506
Alignment:
16 attattcttgttgggttgcgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcttatagcgagc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
10520643 attattcttgttgggttgcgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcgtatagcgagc 10520544  T
116 ttccggatagtgtgaggcttaatgaaggaattggtggt 153  Q
    ||||||||||||||||||||||||||||||||||||||    
10520543 ttccggatagtgtgaggcttaatgaaggaattggtggt 10520506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 34 - 153
Target Start/End: Original strand, 241601 - 241720
Alignment:
34 cgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcttatagcgagcttccggatagtgtgaggc 133  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||  | ||||||||||||   ||| |||||||   | | ||||    
241601 cgtgattatcaggatgataaggctgatgtgatattgaaatatatgccggatgaggcgaggctattgaaggcttatgatgagattccggaatctattaggc 241700  T
134 ttaatgaaggaattggtggt 153  Q
    |||||||||| |||| ||||    
241701 ttaatgaaggtattgctggt 241720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University