View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_high_53 (Length: 249)
Name: NF2766_high_53
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 53854678 - 53854913
Alignment:
| Q |
9 |
agaagaaaagacacgtggcggaaggaaattggaatagtaggaaggagagaagtggtggtgggacccagatgctcacgtgtatatgtatagacagggcaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53854678 |
agaagaaaagacacgtggcggaaggaaattggaatagtaggaaggagagaagtggtggtgggacccagatgctcacgtgtatatgtatagacagggcaaa |
53854777 |
T |
|
| Q |
109 |
tctgggaatcggtagccatggtcgaatcacttcccggatctcatcacttcaaccacattcacattcataaccctctcaatttcgaacattctacactctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53854778 |
tctgggaatcggtagccatggtcgaatcacttcccggatctcatcacttcaaccacattcacattcataaccctctcaatttcgaacattctacactctc |
53854877 |
T |
|
| Q |
209 |
aaatcaaacatttcaaaacaattattccatttcctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53854878 |
aaatcaaacatttcaaaacaattattccatttcctc |
53854913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University