View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_high_55 (Length: 245)
Name: NF2766_high_55
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_high_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 9376286 - 9376048
Alignment:
| Q |
1 |
ctttagacattctaatccagccatcttgattttaatatccaatttagtaaagatggcatgggactatcaacctataaggacaagtcctatatcagctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9376286 |
ctttagacattctaatccagccatcttgattttaatatccaatttagtaaagatggcatgagactatcaacctataaggacaagtcctatatcagctgaa |
9376187 |
T |
 |
| Q |
101 |
tcttgatttttaggaaccctagtttcaaatagtttatgcagtttatacttaggctttctctcttggcctcttgagtttttaggtgnnnnnnnaaggacta |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
9376186 |
tctagatttttaggaaccctagtttcaaatagtttatgcagtttatacttaggctttctctcttggcctcttgagttttttggtgtttttttaaggacta |
9376087 |
T |
 |
| Q |
201 |
cttgcactttgcaaggcgctcgtatctctccctctctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9376086 |
aatgcactttgcaaggcgctcgtatctctccctctctct |
9376048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University