View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_high_64 (Length: 220)
Name: NF2766_high_64
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_high_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 27 - 203
Target Start/End: Complemental strand, 27422380 - 27422204
Alignment:
| Q |
27 |
taaatcgctcgcattcacaattcacacatacagataaatccctcttccattagaatatgcaaataggtgagcttctcaggagacattaagaaattcttcc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27422380 |
taaatcgctcgcattcacaattcacacatacagataaatccctcttccattagaatatgcaaataggtgagcttctcaggagacattaagaaattcttcc |
27422281 |
T |
 |
| Q |
127 |
atctttcttgcgttgttttcttcatagtttccaacaatagattgtcgagaaaatgaactgtacaaaaatcaaatata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
27422280 |
atctttcttgcgttgttttcttcatagtttccaacaatagattgtcgagaaaacgaactgcacaaaaataaaatata |
27422204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University