View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_high_66 (Length: 215)
Name: NF2766_high_66
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_high_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 73 - 203
Target Start/End: Complemental strand, 54986766 - 54986636
Alignment:
| Q |
73 |
cctgtgaatagaggaaggtgccgaggattgcaattgcagcaccaagggcattgtttggctgaattggtgtgtggaagataatgatcgaagagacaataac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54986766 |
cctgtgaatagaggaaggtgccgaggattgcaattgcagcaccaagggcattgtttggctgaattggtgtgtggaagataatgatcgaagagacaataac |
54986667 |
T |
|
| Q |
173 |
cgagattctcttcatcgtgttccctatgcta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54986666 |
cgagattctcttcatcgtgttccctatgcta |
54986636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 54987000 - 54986938
Alignment:
| Q |
15 |
catcaattatgtcttgcatatagatatagcagcttctaaactacacattactgtttggcctgt |
77 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54987000 |
catcaattgtgtcttgcatatagatatagcagcttctaaactagtcattactgtttggcctgt |
54986938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 73 - 203
Target Start/End: Complemental strand, 7884089 - 7883959
Alignment:
| Q |
73 |
cctgtgaatagaggaaggtgccgaggattgcaattgcagcaccaagggcattgtttggctgaattggtgtgtggaagataatgatcgaagagacaataac |
172 |
Q |
| |
|
|||||||||||| ||||||||| || |||||||| ||||| ||||| |||||| | || |||| ||||||||| ||||||||||| |||||||| || || |
|
|
| T |
7884089 |
cctgtgaatagatgaaggtgccaagaattgcaatggcagctccaagagcattgatgggttgaagtggtgtgtgaaagataatgatggaagagactattac |
7883990 |
T |
|
| Q |
173 |
cgagattctcttcatcgtgttccctatgcta |
203 |
Q |
| |
|
|| ||||||||||| || || ||||||||| |
|
|
| T |
7883989 |
agaaattctcttcattgtatttcctatgcta |
7883959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University