View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_28 (Length: 393)
Name: NF2766_low_28
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 388
Target Start/End: Complemental strand, 24568378 - 24568011
Alignment:
| Q |
19 |
attctaactttgaatatcgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggacggtttgcactcattaga |
118 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568378 |
attctacctttgaatattgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggacggtttgcactcattaga |
24568279 |
T |
|
| Q |
119 |
aggccttaattgttcgatattggtgtcttccctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatgttcattcatatgtacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568278 |
aggccttaattgttcgatattggtgtcttctctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatgttcattcatatgtacat |
24568179 |
T |
|
| Q |
219 |
ccccatgcacattatacattactgcaacacgtgnnnnnnnnntaaaacttgtgcagttattgtgcattcaattgccttaaatttatgnnnnnnnnnnngt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
24568178 |
ccccatgcacattatacattactgcaacacgtgcaaaaaaaataaaacttgtgcagttattgtgcattcaattaccttaaatttatg--tttttttttgt |
24568081 |
T |
|
| Q |
319 |
gtgaatttgttgtagaatattctgcaaaatggttcccttttgtgtaacatatttattatcctatgctact |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
24568080 |
gtgaatttgttgtagaatattctgcaaaatggttcccttttgtgcaacatatttattatcctatactact |
24568011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University