View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_29 (Length: 390)
Name: NF2766_low_29
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Original strand, 5572914 - 5573279
Alignment:
| Q |
18 |
acgtatgattttgtatacatcgtggacaatgtcactgattaattaggcataattcagacaacattctgttcatttgacaaaactgaaaagtnnnnnnnng |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5572914 |
acgtatgattttgtatacatcgtggacaatgtcactgattaattaggcataattcagacaacattctgttcatttgacaaaactgaaaagtaaaaagaag |
5573013 |
T |
|
| Q |
118 |
aggggagcacaaattgctcaactactcccataacgtggaaaaaatcagtaatggtaattggttattcagtgtctgcactgcagccaggcatggctttcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573014 |
aggggagcacaaattgctcaactactcccataacgtggaaaaaatcagtaatggtaattggttattcagtgtctgcactgcagccaggcatggctttcca |
5573113 |
T |
|
| Q |
218 |
gctcaaaaagatattatatctaacaatacatacataattgattaatttaaaattaacggcgtaataatattcatttaagcaggcattgtcactaggcact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573114 |
gctcaaaaagatattatatctaacaatacatacataattgattaatttaaaattaacggcgtaataatattcatttaagcaggcattgtcactaggcact |
5573213 |
T |
|
| Q |
318 |
gttgctgtttttgaacccgcaaatagcctaagtggggagtactatagtatatatattttcatctca |
383 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573214 |
gttggtgtttttgaacccgcaaatagcttaagtggggagtactatagtatatatattttcatctca |
5573279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University