View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_32 (Length: 375)
Name: NF2766_low_32
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 151 - 360
Target Start/End: Original strand, 41184882 - 41185092
Alignment:
| Q |
151 |
ggtttcgttgcccttccaagcttttggttttacctcttttgcttgaaacactttcaaaccacttccctttcgtaatttgttccttcaaaagaattggccc |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41184882 |
ggtttcgatgcccttccaagcttttggttttacctcttttgcttgacacactttcaaaccacttccctttcgtaatttgttccttcaaaagaattgtccc |
41184981 |
T |
 |
| Q |
251 |
ggatattgtccatttggaagtttgagtggcaatataaccatattcaaacattaaa-tttgactacacacacgtttgtcaccgttcgtccgactcacttgc |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41184982 |
agatattgtccatttggaagtttgagtggcaatataaccatattcaaacattaaattttgaccacacacacgcttgtcaccgttcgtccgactcacttgc |
41185081 |
T |
 |
| Q |
350 |
gctaaggattt |
360 |
Q |
| |
|
||| ||||||| |
|
|
| T |
41185082 |
gcttaggattt |
41185092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 41184750 - 41184829
Alignment:
| Q |
20 |
agagaacatattcaacttgaccacaaca-atgtgttgacgtccatccgatcgactcgcctcggcttgggccatgtggtgt |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
41184750 |
agagaacatattcaacttgaccaccacacatgtgttgacgtccatccgatcaactcgcccaggcttgggccatgtggtgt |
41184829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University