View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_36 (Length: 348)
Name: NF2766_low_36
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 114 - 326
Target Start/End: Original strand, 9362136 - 9362344
Alignment:
| Q |
114 |
tttaattaaaaatatccaactatgtaccatctaactgaaagtctaatcaaatatcttccaatagataacaaacggtattatgcacaaatgacataatcat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9362136 |
tttaattaaaaatatccaactatgtaccatctaactgaaagtctaatcaaatatcttccaatagataacaaacggtattatgcacaaatgacata---at |
9362232 |
T |
|
| Q |
214 |
ctatctcatccaaacgatattaggtgaannnnnnnnnattgaatatagtaaagtaaaactattttagtttctttgttaaaaagaatacttttaagaaata |
313 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9362233 |
ctatctcatccaaacgatattaggtgaa-ttttttttattgaatatagcaaagtaaaactattttaatttctttgttaaaaagaatacttttaagaaata |
9362331 |
T |
|
| Q |
314 |
aatcacacaacaa |
326 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9362332 |
aatcacacaacaa |
9362344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 9362023 - 9362062
Alignment:
| Q |
1 |
attgaagcttgcggagataaaattttcaatttctagtttt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9362023 |
attgaagcttgcggagataaaattttcaatttctagtttt |
9362062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University