View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_46 (Length: 280)
Name: NF2766_low_46
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 264
Target Start/End: Original strand, 32016619 - 32016882
Alignment:
| Q |
11 |
taattctagaggatggtttgaatcctgtggaggaaaaggtgtttgattacttttggaaaagcccggccccgtcaaaagttgtggctttttcttg------ |
104 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| ||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32016619 |
taattttagaggatggtttgaatccggtggaggaagaggtgtttggttacctttggaaaagcccagccccgtcaaaagttgtggctttttcttggaaact |
32016718 |
T |
|
| Q |
105 |
----cgtgatcggattcctacgggaggaatcttgccattcagaatttattggacccgaaaagttcgaccaattgtgttttttgcgatgcttaggtagaat |
200 |
Q |
| |
|
||| ||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32016719 |
tcttcgtaatcggattcctacaggagaaatcttgccattcagaatttattggatccgaaaagttcgaccaattgtgttttttgcgatgcttcggtagaat |
32016818 |
T |
|
| Q |
201 |
cttcaacgcatcttttcttgcattgtagtgttatttctaagaattggaggaaaatcatgggatt |
264 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32016819 |
cttcaacacatattttcttgcattgtagtgttatttctaagaattggaggaaaatcatgggatt |
32016882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 7425062 - 7425105
Alignment:
| Q |
62 |
tttggaaaagcccggccccgtcaaaagttgtggctttttcttgc |
105 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7425062 |
tttggaagagcccggctcggtcaaaagttgtggctttttcttgc |
7425105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University