View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_56 (Length: 255)
Name: NF2766_low_56
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_56 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 5262389 - 5262625
Alignment:
| Q |
19 |
tgtaatgcttcgttattgctcttctctcttctcaagcgtcctctaatattctaaaaatactctccttcagattatataatttaaacttttatttaaagat |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5262389 |
tgtaatgcttcgctattgctcttctctcttctcaagcgtcctctaatattctaaaaatactctccttctgattatataatttaaacttttatttaaagac |
5262488 |
T |
|
| Q |
119 |
ttttagactatataatctgaaaccttcttgtaaataagtctaattgagaagctccttcgttttcatagttaggttacttcacaaaaattattctttcacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5262489 |
ttttagactatataatctgaaaccttcttgtaaataagtctaaccgagaaactccttcgttttcatagttaggttacttcacaaaaattgttctttcacc |
5262588 |
T |
|
| Q |
219 |
atccaaaatcaaaattgtgtgattcttgaaggttttt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5262589 |
atccaaaatcaaaattgtgtgattcttgaagggtttt |
5262625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University