View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_68 (Length: 231)
Name: NF2766_low_68
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 21590574 - 21590772
Alignment:
| Q |
23 |
cggcgccacctcttccgccgcttcttctctcgccggtgacacctccggttatagtccaagtattcaatcaccatcttcctctggtttccggttactcaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21590574 |
cggcgccacctcttccgccgcttcttctctcgccggtgacacctccggttatagtccaagtattcaatcaccatcttcctctggtttccggttactcaaa |
21590673 |
T |
 |
| Q |
123 |
tcacctaaggtttgcacttttcactacccttttacttgtttggatataaagtttcattttttgttgttgggttgtttctaaagttacccctttgcttct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21590674 |
tcacctaaggtttgcacttttcactacccttttacttgtttggatataaagtttcattttttgttgttgggttgtttctaaagttacccttttgcttct |
21590772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University