View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2766_low_76 (Length: 214)
Name: NF2766_low_76
Description: NF2766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2766_low_76 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 9943936 - 9944149
Alignment:
| Q |
1 |
gattgtggttaagtgttagggaaaatgtccattccatgtgaggtttagtagatatgaaccaaaaacttactttgttcttgctaggaataaccctgaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
9943936 |
gattgtggttaagtgttagggaaaatgtccattccatgtgaggtttagaacatatgaaccaaaaacatactttgttcttgttaggaataaccctgaccat |
9944035 |
T |
|
| Q |
101 |
aaatgttataacactgaaaaaatttggttgattaagactgctttgttggctgagaaactgataccaattctgaaactctcatctggtatgaaacttaagg |
200 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9944036 |
aaatgttataacactggaaaaattaggttgattaagactgctttgttggctaagaaactggtaccaattctgaaacactcatctggtatgaaacttaagg |
9944135 |
T |
|
| Q |
201 |
aattgcaatcaact |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9944136 |
aattgcaatcaact |
9944149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 121
Target Start/End: Complemental strand, 29921961 - 29921866
Alignment:
| Q |
26 |
tgtccattccatgtgaggtttagtagatatgaaccaaaaacttactttgttcttgctaggaataaccctgaccataaatgttataacactgaaaaa |
121 |
Q |
| |
|
||||||||||| |||||||||| | || ||| || ||||| ||||||||||||||||| |||||||||| ||||| ||| | ||||||| |||| |
|
|
| T |
29921961 |
tgtccattccacatgaggtttagcaaatctgagcccaaaacatactttgttcttgctagatataaccctgatcataagtgtcacaacactggaaaa |
29921866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University