View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_high_25 (Length: 319)
Name: NF2767_high_25
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_high_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 10 - 319
Target Start/End: Complemental strand, 17429517 - 17429208
Alignment:
| Q |
10 |
catcatcaaagtaatggaatccgaagcagacccaatttccctcttcagcttttagagaaaaaagacagcaacatcctagatgtctccgaagaacaaactt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17429517 |
catcatcaaagtaatggaatccgaagcagacccaatttccctcttcagcttttagagaaaaaagacaacaacatcctagatgtctccgaagaacaaactt |
17429418 |
T |
 |
| Q |
110 |
gtacaaccaccggaaacgatggttgtactaccataatctcatcagaccagcagaaaaagcctccgccgaagcgagcttcgacgaaagaccggcacactaa |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17429417 |
gtacaaccaccggaaacgatggctgtactgccataatctcatcagaccagcagaaaaagcctccgccgaagcgagcttcgacgaaagaccggcacacgaa |
17429318 |
T |
 |
| Q |
210 |
ggtagacggacgaggccgcaggatccgtatgccggcgtcctgtgctgccagcgtgttccagctcacgcgtgagctcggacataaatcagaatgccagacg |
309 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||| || ||||||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
17429317 |
ggtagacggacgaggccgccggatccgtatgccggcggcctgtgctgctagagtgttccagctcacgcgtgagctgggacataaatcagacggcgagacg |
17429218 |
T |
 |
| Q |
310 |
attgcgtggc |
319 |
Q |
| |
|
|||| ||||| |
|
|
| T |
17429217 |
attgagtggc |
17429208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University