View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_high_35 (Length: 284)
Name: NF2767_high_35
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 34076932 - 34076863
Alignment:
| Q |
1 |
aggacgatgacggcgatggagatgttagtgaagaagaattgaagagattgggagttaaggttttgaaatt |
70 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076932 |
aggaccatgactgcgatggagatgttagtgaagaagaattgaagagattgggagttaaggttttgaaatt |
34076863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 34076770 - 34076711
Alignment:
| Q |
163 |
caagtggaaaaggcgagtgttgttgtggggagagggaattggagttggaggcaatatggg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076770 |
caagtggaaaaggcgagtgttgttgtggggagagggaattggagttggaggcaatatggg |
34076711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University