View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2767_high_35 (Length: 284)

Name: NF2767_high_35
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2767_high_35
NF2767_high_35
[»] chr5 (2 HSPs)
chr5 (1-70)||(34076863-34076932)
chr5 (163-222)||(34076711-34076770)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 34076932 - 34076863
Alignment:
1 aggacgatgacggcgatggagatgttagtgaagaagaattgaagagattgggagttaaggttttgaaatt 70  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34076932 aggaccatgactgcgatggagatgttagtgaagaagaattgaagagattgggagttaaggttttgaaatt 34076863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 34076770 - 34076711
Alignment:
163 caagtggaaaaggcgagtgttgttgtggggagagggaattggagttggaggcaatatggg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34076770 caagtggaaaaggcgagtgttgttgtggggagagggaattggagttggaggcaatatggg 34076711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University