View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_high_42 (Length: 262)
Name: NF2767_high_42
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 37608758 - 37608527
Alignment:
| Q |
11 |
atcatcaattgcccaagatggtaaatcacgtaaggaaaatatggtggctagttttagttttgtatagactgtagagtgaaacagagaaaaagcctaagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37608758 |
atcatcaattgcccaagatggtaaatcacgtaaggaaaatatggtggctagttttagttttgtatagactgtagagtgaaacagagaaaaagcctaagaa |
37608659 |
T |
 |
| Q |
111 |
ggnnnnnnntaggacaagttacagaaaagagtaatgttgaagaaattgctcacaaatattgcatgggaaagggttatctatgactatatgtgacataatt |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37608658 |
ggaaaaaaataggacaagttacagaaaagagtaatgttgaagaaattgctcacaaatattgcatgggaaagggttatctatgactatatgtgacataatt |
37608559 |
T |
 |
| Q |
211 |
gtgtaggggtaaacagcatcttgtgatcttct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37608558 |
gtgtaggggtaaacagcatcttgtgatcttct |
37608527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University