View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_low_16 (Length: 456)
Name: NF2767_low_16
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 333 - 430
Target Start/End: Original strand, 5266657 - 5266754
Alignment:
| Q |
333 |
cagtttgatttgtgccactactatggtcttatttgtgtcgcaaaatcagcataaatttgcataaaagtgtgttcattgtcacaaacaagtttggcatc |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5266657 |
cagtttgatttgtgccactactatggtcttatttgtgtcgcaaaatcagcgtaactttgcataaaagtgtgttcattgtcgcaaacaagttcggcatc |
5266754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 122 - 194
Target Start/End: Complemental strand, 5059350 - 5059278
Alignment:
| Q |
122 |
gttttctcattgtaaaatcatcccttaagaaaagtttgaacattcactttgtaccaatgttttaaaaactgga |
194 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5059350 |
gttttcttatggtaaaatcatcccttaagaaaagtatgaacattcactttgtgccaatgttttaaaaactgga |
5059278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 5065059 - 5064995
Alignment:
| Q |
17 |
acataaaaggtatgaaaaaagttttctgaatgagaagtataaactgtagtgcgtgggttggttct |
81 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
5065059 |
acataaaaggtatgatagaagttttctgaatgggaagtataaactgtagtgtgtggattggttct |
5064995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 126 - 162
Target Start/End: Complemental strand, 5168707 - 5168671
Alignment:
| Q |
126 |
tctcattgtaaaatcatcccttaagaaaagtttgaac |
162 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
5168707 |
tctcattgtaaaatcatcacttaaaaaaagtttgaac |
5168671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University