View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_low_18 (Length: 430)
Name: NF2767_low_18
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 112 - 428
Target Start/End: Complemental strand, 46279336 - 46279020
Alignment:
| Q |
112 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacatgctaccg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279336 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacatgctaccg |
46279237 |
T |
|
| Q |
212 |
tacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279236 |
tacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttg |
46279137 |
T |
|
| Q |
312 |
gaatgttatgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccactttct |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279136 |
gaatgttatgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccactttct |
46279037 |
T |
|
| Q |
412 |
tgtttgtttctgttctg |
428 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46279036 |
tgtttgtttctgttctg |
46279020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 46279447 - 46279392
Alignment:
| Q |
1 |
ctatgatgttcaattctctcaataacctgcaacaagtaagttcaaattagccatgc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46279447 |
ctatgatgttcaattctctcaataaccttcaacaagtaagttcaaattagccatgc |
46279392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University