View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2767_low_34 (Length: 296)
Name: NF2767_low_34
Description: NF2767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2767_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 21 - 196
Target Start/End: Original strand, 40474047 - 40474227
Alignment:
| Q |
21 |
tagagtttgaaatcatagaaatcttgtcatgtgtt-----gttctttttcgtacttagttttaactcatcaaacacatccttattagaagatttcagact |
115 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40474047 |
tagagtttcaaaccatagaaatcttgtcatgtgttagttagttctttttcgtacttagttttaactcatcaaacacatccttattagaagatttcagact |
40474146 |
T |
 |
| Q |
116 |
tatttaatttttcagtattaatgttaaatatattccattaatttttaattgatcaaacacacttgttaagagattgctgac |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
40474147 |
tatttaatttttcagtattaatattaaatatattccattaatttttaactcatcaaacacacttgttaagagattgctgac |
40474227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University