View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2768_high_13 (Length: 255)
Name: NF2768_high_13
Description: NF2768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2768_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 47527440 - 47527344
Alignment:
| Q |
12 |
atgaaaacccatgcaacatgaatttttaatctttttgttttcctaaataacttgatagaagttaaacagtgtcaaacggtaagggaggtcaacgttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527440 |
atgaaaacccatgcaacatgaatttttaatctttttgttttcctaaataacttgacagaagttaaacagtgtcaaacggtaagggaggtcaacgttg |
47527344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 138 - 220
Target Start/End: Complemental strand, 47527342 - 47527260
Alignment:
| Q |
138 |
atttaaaaataaacccacgagaggtgaatgtaattatctctaatttatattgttggccactaattaacacaagtgactcaaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527342 |
atttaaaaataaacccacgagaggtgaatgtaattatctctaatttatattgttggccactaattaacacaagtgactcaaat |
47527260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 144
Target Start/End: Original strand, 29058466 - 29058554
Alignment:
| Q |
56 |
aaataacttgatagaagttaaacagtgtcaaacggtaagggaggtcaacgttgagtgtgaaaatagagggggtatcaatgtcatttaaa |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || |||||||||| ||| | | |||||||| |||||| || ||||||||||| |
|
|
| T |
29058466 |
aaataacttgacggaagttaaacagtgtcaaataataggggaggtcaatgttaaataagaaaatagtgggggtgtctgtgtcatttaaa |
29058554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 144
Target Start/End: Complemental strand, 29594912 - 29594824
Alignment:
| Q |
56 |
aaataacttgatagaagttaaacagtgtcaaacggtaagggaggtcaacgttgagtgtgaaaatagagggggtatcaatgtcatttaaa |
144 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| || |||||||||| ||| | | ||||||||||||||| || ||||||||||| |
|
|
| T |
29594912 |
aaataacttgacggaagttaaacaatgtcaaataataggggaggtcaatgttaaataagaaaatagagggggtgtctgtgtcatttaaa |
29594824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University